Methods for use with the mTn-3xHA/lacZ-mutagenized library

The following protocols are included:

Making library DNA from the DNA we send you

The original library was distributed as 18 individual pools. After 8/98, there is a new library that is distributed as 10 pools. You will be sent about a microgram of each pool in the form of DNA. Transform a suitable amount into E. coli (use any kanamycin- and tetracycline-sensitive strain suitable for making plasmid preps). Select transformants with 40 ug/ml kanamycin and/or 3ug/ml tetracycline (allow at least an hour for expression following transformation). Obtain 50,000 colonies for each pool. Elute colonies from plates in LB; make a -70oC stock of this eluate. Dilute eluate into LB plus antibiotic to give a culture with an almost saturated density. Grow at 37oC for a few hours. Make miniprep or midiprep DNA.

Transforming yeast with DNA from the insertion library

OVERVIEW: Mutagenized DNA from the library is excised from the bacterial vector. It is then transformed into a ura3 strain of yeast. This procedure is outlined in this figure. The best strategy is to screen a few thousand transformants from each pool. Use of a circle-zero strain will prevent recovery of insertions in the 2-micron plasmid. For libraries distributed after 8/98, the genomic library was made from a circle-zero strain (also rho-minus) so this is not necessary. Screening 30, 000 transformants should give you 95% coverage of the yeast genome.

To minimize double integrants, transformations should contain the lowest amount of DNA practicable. We therefore recommend that a pilot experiment be performed to determine transformation efficiency of the strain, and conditions then be scaled up as appropriate. The pilot protocol given below uses a modified version of the method of Chen et al. (1992). You should use whatever transformation protocol works best in your hands.

  1. Plasmid DNA from pools of the mTn-3xHA/lacZ-mutagenized genomic library is digested with NotI. A 2.1-kb band from the vector should be very apparent, together with a broad band in the 8-kb region, representing inserts. Because sized genomic DNA was used to make the library, the insert bands are not very heterogeneous in size.
  2. A 10-ml culture of the yeast host strain is grown to a density of 107 cells/ml (O.D. 600 of 1). Use of such logarithmically-dividing cultures increases transformation efficiency.
  3. Cells are pelleted and washed once with 5 volumes of One Step buffer (0.2M LiAc, 40% PEG 4000, 100 mM beta-mercaptoethanol). This wash is especially important when culture volumes are increased.
  4. Cells are resuspended in 1 ml of One Step buffer containing 1 mg of denatured salmon sperm DNA. 100 ul aliquots of this suspension are then added to tubes containing from 0.1 to 1 ug of NotI digested plasmid DNA.
  5. Tubes are vortexed to mix the contents thoroughly, then incubated at 45oC for 30 minutes.
  6. Cells are pelleted and resuspended in 400 ul of SC-ura. 200 ul is plated onto SC-ura medium. Plates are incubated at 30oC for 3 to 4 days.

Screening for gene expression using lacZ fusions

OVERVIEW: Transformant strains carrying in-frame fusions between yeast genes and lacZ are identified by a color assay for beta-galactosidase activity.

  1. To maximize detection of lacZ fusions expressed at a low level, transformant colonies can be patched to YPAD plates at a density of 100 per plate.
  2. To identify vegetatively expressed genes, cells are replica plated to an SC-ura plate on which a sterile disc of Whatman 1A filter paper has been placed, and grown overnight at 30oC. Other media or growth conditions can be substituted as desired. For ade2 strains, any test media should contain 80 mg/l of adenine.
  3. Filters are lifted from the plates and placed in the lid of a 9-cm glass petri dish. This lid is then placed inside a closed 15-cm glass petri dish containing chloroform for 10 to 30 minutes. The minimum exposure time necessary for a particular yeast strain can be determined empirically.
  4. Filters are placed colony-side up onto X-Gal plates (120 ug/ml 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside, 0.1 M NaPO4 [pH 7] and 1 mM MgSO4 in 1.6% agar) and incubated at 30oC for up to 2 days. These plates can be very thin; their use increases the signal over that obtained by simply soaking the filters in a buffered X-gal solution.
  5. Transformants carrying productive lacZ fusions are recovered from the regrown YPAD plates. It is advisable to subsequently maintain selection for URA3 wherever possible, as some mutations are deleterious even in the heterozygous state.

Identification of the genomic site of transposon insertion

OVERVIEW: To determine the site of transposon insertion, genomic DNA imediately adjacent to the lacZ sequences is rescued in Escherischia coli (see figure). To introduce an origin of replication (ori), a plasmid marked with LEU2 (pRSQ2-LEU2, U64693) replaces part of the transposon by recombination between plasmid- and transposon-borne copies of lacZ sequences. Yeast DNA is recovered from these transformants and cut with a 'recovery' enzyme (EcoRI, HindIII, ClaI, SalI, XhoI, KpnI). This releases as a linear segment the bacterial origin of replication, the beta-lactamase gene and a portion of the lacZ gene with adjacent yeast DNA; this fragment is then circularized and recovered in bacteria. pRSQ2 is high copy number in E. coli. Plasmids are sequenced using a primer complementary to the 5' end of the transposon. This process requires the three protocols given below.

Alternative method: Carl Friddle (http://genome-www.stanford.edu/group/botlab) has developed a vectorette PCR rescue protocol for lacZ-based transposons. I have transcribed Carl's protocol and modified the suggested enzymes and primers, to make it suitable for vectorette PCR of the mTn-3xHA-based transposons.

CAUTION! Two or more insertion events may have occurred. These can be identified by examination of segregation of the transposon-borne URA3 marker upon tetrad dissection. You should be sure that the strain has only one transposon before proceeding to recovering a plasmid containing genomic DNA. If you have used the library for mutagenesis, you are strongly advised to make sure that your phenotype is linked to the transposon insertion, since spontaneous mutations can arise at other sites. You can waste time recovering junk if you don't check.

Transformation of yeast strains

We suggest transforming the yeast with 1-5ug of BamHI-digested pRSQ2-LEU plasmid DNA, selecting the transformants on SC-leu-ura. This is a targetted replacement, so efficiency will depend on your strain. The method of Chen et al. (1992) given above can be used. If an ampR plasmid is present in the yeast strain to be transformed, a different marker could be cloned into the pRSQ2 polylinker to enable its recovery.

Recovery of genomic DNA from yeast strains

For a detailed discussion of genomic DNA preparation from yeast, see Philippsen et al. (1991). Here is the method that we use.

  1. Yeast strains are grown to saturation at 30oC in 2 ml of YPAD. We suggest using a couple of transformants for each strain.
  2. Cells are recovered by centrifugation at 13,000 r.p.m. for 1 minute. The supernatant is removed by aspiration and cells are resupended in 250 ul of 0.1 M EDTA (pH 7.5), 14 mM [[beta]]-mercaptoethanol containing 150 ug/ml zymolyase. Cells are incubated at 37oC until spheroplasted. Overspheroplasting does not affect recovery.
  3. 50 ul of miniprep mix (0.25 M EDTA (pH 8.5), 0.5 M Tris base, 2.5% SDS) is added to each tube. Samples are mixed by inversion, then incubated in a water bath at 65oC for 30 minutes.
  4. 63 ul of 5 M KAc is added to each sample. Samples are mixed by inversion and incubated on ice for 30 minutes.
  5. Samples are spun at 13000 r.p.m. in a microfuge for 10 minutes. Supernatants are transferred by pouring each sample into a new tube containing 720 ul of 100% ethanol. A DNA precipitate should be visible. Samples are mixed by inversion and spun for 5 minutes as above.
  6. Tubes are drained thoroughly, and 130 ul TE containing 1 mg/ml RNAase A is added to the undried pellets. Resupension of DNA is gradual and occurs during subsequent incubation at 37oC for 35 minutes with occasional vortexing, DNA is reprecipitated by addition of 130 ul of isopropanol. Samples are mixed by inversion and spun for 5 minutes as above.
  7. Tubes are drained. A 70% ethanol wash may be performed to remove salt. Finally, pellets are air dried and resupended in 40 ul of TE with incubation at 37oC. About 10ug of genomic DNA is obtained.

Plasmid rescue

  1. 5 ug of yeast genomic DNA is digested overnight at 37oC with 5 units of 'recovery' enzyme (e.g. EcoRI, HindIII, SalI, ClaI, XhoI, or KpnI) in a volume of 40 ul.
  2. 20 ul of the sample is run on a gel to check digestion. The remainder is heated to 65oC for 25 minutes to inactivate the restriction enzyme, and 215 ul of H2O, 25 ul of 10X ligase buffer and 1 ul of ligase (400 units) are added. To favour intramolecular reactions, the DNA concentration in the ligation should not be over 10 ug/ml, and can be as low as 2 ug/ml.
  3. After ligation at 16oC for 4 to 16 hours, DNA is precipitated by addition of 125 ul of 7.5 M NH4Ac and 375 ul of isopropanol and recovered by mini-centrifugation at 13,000 rpm for 20 minutes.
  4. The DNA pellet is washed once with 70% ethanol, then resuspended in 6-20 ul of TE. 3 ul of this is transformed into E. coli, (we use electroporation) selecting for ampicillin resistance. Do minipreps of several colonies for each strain.
  5. Rescued plasmids can be analyzed by double-digestion with BamHI and the 'recovery' enzyme. Desired plasmids display a 2.85-kb band containing vector sequences (3.9kb for EcoRI; see Figure 2) plus additional band(s) from genomic DNA. If you get 'mystery' plasmids, try a different transformant/ recovery enzyme.
  6. DNA preparations may be sequenced using a primer complementary to sequences just inside the inverted repeat (cttctaccttcaatggccgc). Only trust your sequence up to the first site for the recovery enzyme, as other fragments can get cloned in during circularization.

Sequence of lacZ end of mTn3-3xHA

Upper case indicates terminal repeat element also present in vector:

GGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGgcggccattgaaggtagaag

The accession for mTn-3xHA/lacZ is U54828.

Transferring the disruption allele to other strains:

When pRSQ2-LEU2 integrates into mTn-3xHA it creates an 11.8 kb insertion. This element is not cleaved by the following enzymes: AscI, AvrII, BspEI, MscI, NotI, PmeI, PmlI, SacII, SnaBI, SpeI. These enzymes can therefore be used to recover a large plasmid containing sequences both 5' and 3' to the transposon insertion. We have successfully 'moved' disruptions by this strategy.

Using the HAT epitope tagging feature of mTn-3xHA/lacZ

When transposon insertion has created an in-frame fusion to lacZ in the gene of interest, the transposon can be excized to leave a 274 bp insertion (sequence given below) containing the 3xHA tag. With the 5 base pair duplication caused by transposon insertion, this gives an in-frame 93-amino acid insertion in the protein. The popout event is mediated by cre recombinase and requires induction of the GAL1-10 promoter on galactose. Our strains grow poorly on galactose but give 80 to 100% popouts.

The HA triple tag can be detected by mouse monoclonal antibodies 12CA5 (Boehringer) or MMS101R (BAbCo, Richmond, California). These antibody recognise cross-reacting yeast proteins of about 55kD or 110kD, respectively, and can give a spotty background on immunofluorescence. Despite this drawback, the 3xHA tag has been used extensively and successfully in yeast. A rabbit polyclonal antisera is also available (101c500; BabCo) but this was less reactive in the one instance we tried. Protocols for yeast immunofluorescence can be found here, or in Methods in Enzymology 194 (1991).

  1. Transform strain with pB227/GAL-cre, selecting on SC-leu.
  2. To derepress the GAL promoter, inoculate transformants into 2 mls SC-ura-leu with 2% raffinose as carbon source and grow to saturation.
  3. Dilute 1/100 into SC-leu with 2% galactose as carbon source (control: SC-leu with 2% glucose as carbon source). Grow for 2 days (some strains induce without growing).
  4. If grown, dilute 1/100. Spot a 10ul drop onto an FOA plate and streak it for singles (non-quantitative approach!). Or plate dilutions onto SC media and replica to identify ura- colonies. The induced cultures should give 100x more ura- cells than the control.
  5. PCR primers designed using the sequence given below can be used to determine position of the tag. The IR elements and palindromic loxR region should be avoided.

N.B. When tagging essential genes, the original strain transformed should obviously be diploid. You can dissect the popped-out version to see if the tagged gene is functional. Only believe a tag is lethal if it is complemented by the wild-type gene, and if several popout events give the same phenotype.

Sequence of HAT tag (3xHA):

TR in upper case. loxR in bold.

GGGGTCTGAC GCTCAGTGGA ACGAAAACTC ACGTTAAGgc ggccattgaa ggtagaagag aaaatttgta cttccaaaga aagaaggccg ctatcgcttc ggataactcc tgctatacga agttatgggc ggccgtttac ccatacgatg ttcctgacta tgcgggctat ccctatgacg tcccggacta tgcaggatcc tatccatatg acgttccaga ttacgctccg gccgcCCTTA ACGTGAGTTT TCGTTCCACT GAGCGTCAGA CCCC

GenBank accession

Antibiotics used:

Tetracycline, Tet (Sigma T3383)12 mg/ ml in 50% ethanol. Use at 3 ug/ml (Tet3)
Kanamycin, Kan (Sigma K800) 10 mg/ ml in water. Use at 40 ug/ml (Kan40)
Ampicillin, Amp (Sigma A9518)50 mg/ml in water. Use at 50 ug/ml (Amp50)

YGAC Home page | TRIPLES | The current project | Insertion libraries | Protocols | Reagents | Publications | Project personnel | Protein Microarray | Other Lab Protocols (ChIp-ChIp)